Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. RID: 1034079738-09374-7643 Query= (60 letters) Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,414,977 sequences; 6,904,618,414 total letters If you have any problems or questions with the results of this search please refer to the BLAST FAQs Taxonomy reports
RID: 1034079738-09374-7643
Query= (60 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,414,977 sequences; 6,904,618,414 total letters
If you have any problems or questions with the results of this search please refer to the BLAST FAQs
Taxonomy reports
Score E Sequences producing significant alignments: (bits) Value gi|555008|gb|K02083.1|HIVPV22 Human immunodeficiency virus ... 119 3e-25 gi|1906382|gb|K03455.1|HIVHXB2CG Human immunodeficiency vir... 119 3e-25 gi|60192|emb|Z11530.1|HIVF12CG Human Immunodeficiency virus... 119 3e-25 gi|632882|gb|S72421.1|S72421 {LTR, long terminal repeat} [h... 119 3e-25 gi|61569|emb|X01762.1|REHTLV3 Human T-cell leukaemia type I... 119 3e-25 gi|328381|gb|M74426.1|HIVNEF Human immunodeficiency virus t... 119 3e-25 gi|61556|emb|X03188.1|REHIVXB3 Human T-lymphotropic virus t... 119 3e-25 gi|61552|emb|X03189.1|REHIVC15 Human T-lymphotropic virus t... 119 3e-25 gi|665531|gb|U12055.1|HIV1U12055 Human immunodeficiency vir... 119 3e-25 gi|1398964|dbj|D86069.1|HIV2132 Human immunodeficiency viru... 119 3e-25 gi|474287|gb|L31963.1|HIVTH475A Human immunodeficiency viru... 119 3e-25 gi|328453|gb|M11840.1|HIVPCV12 Human immunodeficiency virus... 119 3e-25 gi|329545|gb|M27499.1|HL2ORF Human T-cell lymphotropic viru... 119 3e-25 gi|326383|gb|M15654.1|HIVBH102 Human immunodeficiency virus... 119 3e-25 gi|326382|gb|M15653.1|HIVBH101 Human immunodeficiency virus... 119 3e-25 gi|4102257|gb|AF011470.1|AF011470 HIV-1 strain 8-it clone b... 115 5e-24 gi|2286133|gb|AF003888.1| HIV-1 chimeric molecular clone, c... 111 8e-23 gi|2286124|gb|AF003887.1| HIV-1 chimeric molecular clone, c... 111 8e-23 gi|6694605|gb|AF203198.1| HIV-1 clone LTNP2-83 from USA nef... 111 8e-23 gi|6694529|gb|AF203160.1| HIV-1 clone SP9-2-88 from USA nef... 111 8e-23 gi|6694527|gb|AF203159.1| HIV-1 clone SP9-1-88 from USA nef... 111 8e-23 gi|6694525|gb|AF203158.1| HIV-1 clone SP9-2-83 from USA nef... 111 8e-23 gi|6694523|gb|AF203157.1| HIV-1 clone SP9-1-83 from USA tru... 111 8e-23 gi|3986717|gb|AF102209.1|AF102209 HIV-1 strain SE5658 from ... 111 8e-23 gi|12831134|gb|AF324493.1|AF324493 HIV-1 vector pNL4-3, com... 111 8e-23 gi|4730963|gb|AF063164.1|AF063164 HIV-1 isolate 9-it clone ... 111 8e-23 gi|4730962|gb|AF063163.1|AF063163 HIV-1 isolate 8-it clone ... 111 8e-23 gi|4730961|gb|AF063162.1|AF063162 HIV-1 isolate 7-it clone ... 111 8e-23 gi|4730960|gb|AF063161.1|AF063161 HIV-1 isolate 7-it clone ... 111 8e-23 gi|327466|gb|K02011.1|HIVH3BH8 HIV-1 isolate BH8 tat protei... 111 8e-23 gi|4105546|gb|AF047087.1|AF047087 HIV-1 isolate 21-sw clone... 111 8e-23 gi|4102305|gb|AF011494.1|AF011494 HIV-1 strain 7-it clone b... 111 8e-23 gi|4102277|gb|AF011480.1|AF011480 HIV-1 strain 12-it clone ... 111 8e-23 gi|4102263|gb|AF011473.1|AF011473 HIV-1 strain 9-it clone a... 111 8e-23 gi|4102255|gb|AF011469.1|AF011469 HIV-1 strain 8-it clone a... 111 8e-23 gi|3378121|gb|AF070521.1|AF070521 HIV-1 E9 from the USA, co... 111 8e-23 gi|3169601|gb|AF063922.1|AF063922 HIV-1 patient 9 from Kore... 111 8e-23 gi|902798|gb|U26942.1|HIV1U26942 Human immunodeficiency vir... 111 8e-23 gi|326417|gb|K02013.1|HIVBRUCG Human immunodeficiency virus... 111 8e-23 gi|415429|gb|S64870.1|S64870 {long terminal repeat, negativ... 111 8e-23 gi|1398973|dbj|D86068.1|HIVMCK1 Human immunodeficiency viru... 111 8e-23 gi|328415|gb|M19921.1|HIVNL43 Human immunodeficiency virus ... 111 8e-23 gi|291194|gb|M33914.1|HIV1U3RA Human immunodeficiency virus... 111 8e-23 gi|4558520|gb|AF033819.3| HIV-1, complete genome 107 1e-21 gi|4028599|gb|AF105229.1|AF105229 Cloning vector pHR'-CMVLa... 107 1e-21 gi|61554|emb|X03187.1|REHIVXB2 Human T-lymphotropic virus t... 107 1e-21 gi|829534|gb|U24480.1|HIV1U24480 Human immunodeficiency vir... 107 1e-21 gi|829533|gb|U24479.1|HIV1U24479 Human immunodeficiency vir... 107 1e-21 gi|829531|gb|U24478.1|HIV1U24478 Human immunodeficiency vir... 107 1e-21 gi|829506|gb|U24474.1|HIV1U24474 Human immunodeficiency vir... 107 1e-21 gi|829504|gb|U24473.1|HIV1U24473 Human immunodeficiency vir... 107 1e-21 gi|829502|gb|U24472.1|HIV1U24472 Human immunodeficiency vir... 107 1e-21 gi|829500|gb|U24471.1|HIV1U24471 Human immunodeficiency vir... 107 1e-21 gi|829498|gb|U24470.1|HIV1U24470 Human immunodeficiency vir... 107 1e-21 gi|829496|gb|U24469.1|HIV1U24469 Human immunodeficiency vir... 107 1e-21 gi|829494|gb|U24468.1|HIV1U24468 Human immunodeficiency vir... 107 1e-21 gi|829492|gb|U24467.1|HIV1U24467 Human immunodeficiency vir... 107 1e-21 gi|829490|gb|U24466.1|HIV1U24466 Human immunodeficiency vir... 107 1e-21 gi|60236|emb|X63045.1|HIVNEF6 HIV-1 nef gene (PCRnef6) 107 1e-21 gi|60119|emb|X63042.1|HIV1NEF3 HIV-1 nef gene (PCRnef3) 107 1e-21 gi|60115|emb|X63040.1|HIV1NEF1 HIV-1 nef gene (PCRnef1) 107 1e-21 gi|4730983|gb|AF063184.1|AF063184 HIV-1 isolate 21-sw clone... 103 2e-20 gi|60142|emb|Z11756.1|HIV1S4S12 Human immunodeficiency viru... 103 2e-20 gi|21633113|gb|AY064932.1| HIV-1 clone MD2 from USA nonfunc... 100 3e-19 gi|6694441|gb|AF203116.1| HIV-1 clone RP8-1-86 from USA nef... 100 3e-19 gi|1794226|gb|U66544.1|HIVU66544 HIV-1 isolate BIB clone 5 ... 100 3e-19 gi|4730968|gb|AF063169.1|AF063169 HIV-1 isolate 12-it clone... 100 3e-19 gi|4730967|gb|AF063168.1|AF063168 HIV-1 isolate 12-it clone... 100 3e-19 gi|1794224|gb|U66543.1|HIVU66543 HIV-1 isolate BIB clone 1 ... 100 3e-19 gi|3169593|gb|AF063917.1|AF063917 HIV-1 patient 924 from Ko... 100 3e-19 gi|6694603|gb|AF203197.1| HIV-1 clone LTNP1-90 from USA nef... 98 1e-18 gi|6694575|gb|AF203183.1| HIV-1 clone SP17-1-84 from USA ne... 98 1e-18 gi|9651346|gb|AF196709.1|AF196709 HIV-1 isolate 97TH50 from... 98 1e-18 gi|4730984|gb|AF063185.1|AF063185 HIV-1 isolate 21-sw clone... 98 1e-18 gi|1177189|gb|U44460.1|HIVU44460 Human immunodeficiency vir... 98 1e-18 gi|1177182|gb|U44455.1|HIVU44455 Human immunodeficiency vir... 98 1e-18 gi|1177180|gb|U44454.1|HIVU44454 Human immunodeficiency vir... 98 1e-18 gi|1177178|gb|U44453.1|HIVU44453 Human immunodeficiency vir... 98 1e-18 gi|1177170|gb|U44449.1|HIVU44449 Human immunodeficiency vir... 98 1e-18 gi|1177168|gb|U44448.1|HIVU44448 Human immunodeficiency vir... 98 1e-18 gi|1177166|gb|U44447.1|HIVU44447 Human immunodeficiency vir... 98 1e-18 gi|1177158|gb|U44443.1|HIVU44443 Human immunodeficiency vir... 98 1e-18 gi|306008|gb|L15485.1|HIVNEF164D Human immunodeficiency vir... 98 1e-18 gi|306004|gb|L15483.1|HIVNEF164B Human immunodeficiency vir... 98 1e-18 gi|5713169|gb|AF166101.1|AF166101 HIV-1 isolate HIV-1LAI fr... 96 5e-18 gi|1750082|gb|U81470.1|HIVU81470 HIV-1 patient VE17 from Ve... 96 5e-18 gi|606463|gb|U03296.1|HIV1U03296 HIV-1 clone NEF10 Nef (nef... 94 2e-17 gi|21633125|gb|AY064939.1| HIV-1 clone MD9 from USA nef pro... 92 7e-17 gi|21633123|gb|AY064938.1| HIV-1 clone MD8 from USA nef pro... 92 7e-17 gi|21633117|gb|AY064935.1| HIV-1 clone MD5 from USA nef pro... 92 7e-17 gi|21633114|gb|AY064933.1| HIV-1 clone MD3 from USA nonfunc... 92 7e-17 gi|21633111|gb|AY064931.1| HIV-1 clone MD1 from USA nef pro... 92 7e-17 gi|1620673|gb|U72074.1|HIVU72074 HIV-1 clone pMCE36.1 from ... 92 7e-17 gi|21632979|gb|AY064861.1| HIV-1 clone IF5 from USA nef pro... 90 3e-16 gi|6694601|gb|AF203196.1| HIV-1 clone LTNP1-89 from USA nef... 90 3e-16 gi|6694581|gb|AF203186.1| HIV-1 clone SP17-3-91 from USA ne... 90 3e-16 gi|6694577|gb|AF203184.1| HIV-1 clone SP17-2-84 from USA ne... 90 3e-16 gi|6694509|gb|AF203150.1| HIV-1 clone SP5-2-88 from USA nef... 90 3e-16 gi|6694499|gb|AF203145.1| HIV-1 clone SP5-1-84 from USA nef... 90 3e-16 gi|18201560|gb|AF219819.1|AF219819 HIV-1 isolate LTS 8a fro... 90 3e-16 Alignments
Score E Sequences producing significant alignments: (bits) Value gi|555008|gb|K02083.1|HIVPV22 Human immunodeficiency virus ... 119 3e-25 gi|1906382|gb|K03455.1|HIVHXB2CG Human immunodeficiency vir... 119 3e-25 gi|60192|emb|Z11530.1|HIVF12CG Human Immunodeficiency virus... 119 3e-25 gi|632882|gb|S72421.1|S72421 {LTR, long terminal repeat} [h... 119 3e-25 gi|61569|emb|X01762.1|REHTLV3 Human T-cell leukaemia type I... 119 3e-25 gi|328381|gb|M74426.1|HIVNEF Human immunodeficiency virus t... 119 3e-25 gi|61556|emb|X03188.1|REHIVXB3 Human T-lymphotropic virus t... 119 3e-25 gi|61552|emb|X03189.1|REHIVC15 Human T-lymphotropic virus t... 119 3e-25 gi|665531|gb|U12055.1|HIV1U12055 Human immunodeficiency vir... 119 3e-25 gi|1398964|dbj|D86069.1|HIV2132 Human immunodeficiency viru... 119 3e-25 gi|474287|gb|L31963.1|HIVTH475A Human immunodeficiency viru... 119 3e-25 gi|328453|gb|M11840.1|HIVPCV12 Human immunodeficiency virus... 119 3e-25 gi|329545|gb|M27499.1|HL2ORF Human T-cell lymphotropic viru... 119 3e-25 gi|326383|gb|M15654.1|HIVBH102 Human immunodeficiency virus... 119 3e-25 gi|326382|gb|M15653.1|HIVBH101 Human immunodeficiency virus... 119 3e-25 gi|4102257|gb|AF011470.1|AF011470 HIV-1 strain 8-it clone b... 115 5e-24 gi|2286133|gb|AF003888.1| HIV-1 chimeric molecular clone, c... 111 8e-23 gi|2286124|gb|AF003887.1| HIV-1 chimeric molecular clone, c... 111 8e-23 gi|6694605|gb|AF203198.1| HIV-1 clone LTNP2-83 from USA nef... 111 8e-23 gi|6694529|gb|AF203160.1| HIV-1 clone SP9-2-88 from USA nef... 111 8e-23 gi|6694527|gb|AF203159.1| HIV-1 clone SP9-1-88 from USA nef... 111 8e-23 gi|6694525|gb|AF203158.1| HIV-1 clone SP9-2-83 from USA nef... 111 8e-23 gi|6694523|gb|AF203157.1| HIV-1 clone SP9-1-83 from USA tru... 111 8e-23 gi|3986717|gb|AF102209.1|AF102209 HIV-1 strain SE5658 from ... 111 8e-23 gi|12831134|gb|AF324493.1|AF324493 HIV-1 vector pNL4-3, com... 111 8e-23 gi|4730963|gb|AF063164.1|AF063164 HIV-1 isolate 9-it clone ... 111 8e-23 gi|4730962|gb|AF063163.1|AF063163 HIV-1 isolate 8-it clone ... 111 8e-23 gi|4730961|gb|AF063162.1|AF063162 HIV-1 isolate 7-it clone ... 111 8e-23 gi|4730960|gb|AF063161.1|AF063161 HIV-1 isolate 7-it clone ... 111 8e-23 gi|327466|gb|K02011.1|HIVH3BH8 HIV-1 isolate BH8 tat protei... 111 8e-23 gi|4105546|gb|AF047087.1|AF047087 HIV-1 isolate 21-sw clone... 111 8e-23 gi|4102305|gb|AF011494.1|AF011494 HIV-1 strain 7-it clone b... 111 8e-23 gi|4102277|gb|AF011480.1|AF011480 HIV-1 strain 12-it clone ... 111 8e-23 gi|4102263|gb|AF011473.1|AF011473 HIV-1 strain 9-it clone a... 111 8e-23 gi|4102255|gb|AF011469.1|AF011469 HIV-1 strain 8-it clone a... 111 8e-23 gi|3378121|gb|AF070521.1|AF070521 HIV-1 E9 from the USA, co... 111 8e-23 gi|3169601|gb|AF063922.1|AF063922 HIV-1 patient 9 from Kore... 111 8e-23 gi|902798|gb|U26942.1|HIV1U26942 Human immunodeficiency vir... 111 8e-23 gi|326417|gb|K02013.1|HIVBRUCG Human immunodeficiency virus... 111 8e-23 gi|415429|gb|S64870.1|S64870 {long terminal repeat, negativ... 111 8e-23 gi|1398973|dbj|D86068.1|HIVMCK1 Human immunodeficiency viru... 111 8e-23 gi|328415|gb|M19921.1|HIVNL43 Human immunodeficiency virus ... 111 8e-23 gi|291194|gb|M33914.1|HIV1U3RA Human immunodeficiency virus... 111 8e-23 gi|4558520|gb|AF033819.3| HIV-1, complete genome 107 1e-21 gi|4028599|gb|AF105229.1|AF105229 Cloning vector pHR'-CMVLa... 107 1e-21 gi|61554|emb|X03187.1|REHIVXB2 Human T-lymphotropic virus t... 107 1e-21 gi|829534|gb|U24480.1|HIV1U24480 Human immunodeficiency vir... 107 1e-21 gi|829533|gb|U24479.1|HIV1U24479 Human immunodeficiency vir... 107 1e-21 gi|829531|gb|U24478.1|HIV1U24478 Human immunodeficiency vir... 107 1e-21 gi|829506|gb|U24474.1|HIV1U24474 Human immunodeficiency vir... 107 1e-21 gi|829504|gb|U24473.1|HIV1U24473 Human immunodeficiency vir... 107 1e-21 gi|829502|gb|U24472.1|HIV1U24472 Human immunodeficiency vir... 107 1e-21 gi|829500|gb|U24471.1|HIV1U24471 Human immunodeficiency vir... 107 1e-21 gi|829498|gb|U24470.1|HIV1U24470 Human immunodeficiency vir... 107 1e-21 gi|829496|gb|U24469.1|HIV1U24469 Human immunodeficiency vir... 107 1e-21 gi|829494|gb|U24468.1|HIV1U24468 Human immunodeficiency vir... 107 1e-21 gi|829492|gb|U24467.1|HIV1U24467 Human immunodeficiency vir... 107 1e-21 gi|829490|gb|U24466.1|HIV1U24466 Human immunodeficiency vir... 107 1e-21 gi|60236|emb|X63045.1|HIVNEF6 HIV-1 nef gene (PCRnef6) 107 1e-21 gi|60119|emb|X63042.1|HIV1NEF3 HIV-1 nef gene (PCRnef3) 107 1e-21 gi|60115|emb|X63040.1|HIV1NEF1 HIV-1 nef gene (PCRnef1) 107 1e-21 gi|4730983|gb|AF063184.1|AF063184 HIV-1 isolate 21-sw clone... 103 2e-20 gi|60142|emb|Z11756.1|HIV1S4S12 Human immunodeficiency viru... 103 2e-20 gi|21633113|gb|AY064932.1| HIV-1 clone MD2 from USA nonfunc... 100 3e-19 gi|6694441|gb|AF203116.1| HIV-1 clone RP8-1-86 from USA nef... 100 3e-19 gi|1794226|gb|U66544.1|HIVU66544 HIV-1 isolate BIB clone 5 ... 100 3e-19 gi|4730968|gb|AF063169.1|AF063169 HIV-1 isolate 12-it clone... 100 3e-19 gi|4730967|gb|AF063168.1|AF063168 HIV-1 isolate 12-it clone... 100 3e-19 gi|1794224|gb|U66543.1|HIVU66543 HIV-1 isolate BIB clone 1 ... 100 3e-19 gi|3169593|gb|AF063917.1|AF063917 HIV-1 patient 924 from Ko... 100 3e-19 gi|6694603|gb|AF203197.1| HIV-1 clone LTNP1-90 from USA nef... 98 1e-18 gi|6694575|gb|AF203183.1| HIV-1 clone SP17-1-84 from USA ne... 98 1e-18 gi|9651346|gb|AF196709.1|AF196709 HIV-1 isolate 97TH50 from... 98 1e-18 gi|4730984|gb|AF063185.1|AF063185 HIV-1 isolate 21-sw clone... 98 1e-18 gi|1177189|gb|U44460.1|HIVU44460 Human immunodeficiency vir... 98 1e-18 gi|1177182|gb|U44455.1|HIVU44455 Human immunodeficiency vir... 98 1e-18 gi|1177180|gb|U44454.1|HIVU44454 Human immunodeficiency vir... 98 1e-18 gi|1177178|gb|U44453.1|HIVU44453 Human immunodeficiency vir... 98 1e-18 gi|1177170|gb|U44449.1|HIVU44449 Human immunodeficiency vir... 98 1e-18 gi|1177168|gb|U44448.1|HIVU44448 Human immunodeficiency vir... 98 1e-18 gi|1177166|gb|U44447.1|HIVU44447 Human immunodeficiency vir... 98 1e-18 gi|1177158|gb|U44443.1|HIVU44443 Human immunodeficiency vir... 98 1e-18 gi|306008|gb|L15485.1|HIVNEF164D Human immunodeficiency vir... 98 1e-18 gi|306004|gb|L15483.1|HIVNEF164B Human immunodeficiency vir... 98 1e-18 gi|5713169|gb|AF166101.1|AF166101 HIV-1 isolate HIV-1LAI fr... 96 5e-18 gi|1750082|gb|U81470.1|HIVU81470 HIV-1 patient VE17 from Ve... 96 5e-18 gi|606463|gb|U03296.1|HIV1U03296 HIV-1 clone NEF10 Nef (nef... 94 2e-17 gi|21633125|gb|AY064939.1| HIV-1 clone MD9 from USA nef pro... 92 7e-17 gi|21633123|gb|AY064938.1| HIV-1 clone MD8 from USA nef pro... 92 7e-17 gi|21633117|gb|AY064935.1| HIV-1 clone MD5 from USA nef pro... 92 7e-17 gi|21633114|gb|AY064933.1| HIV-1 clone MD3 from USA nonfunc... 92 7e-17 gi|21633111|gb|AY064931.1| HIV-1 clone MD1 from USA nef pro... 92 7e-17 gi|1620673|gb|U72074.1|HIVU72074 HIV-1 clone pMCE36.1 from ... 92 7e-17 gi|21632979|gb|AY064861.1| HIV-1 clone IF5 from USA nef pro... 90 3e-16 gi|6694601|gb|AF203196.1| HIV-1 clone LTNP1-89 from USA nef... 90 3e-16 gi|6694581|gb|AF203186.1| HIV-1 clone SP17-3-91 from USA ne... 90 3e-16 gi|6694577|gb|AF203184.1| HIV-1 clone SP17-2-84 from USA ne... 90 3e-16 gi|6694509|gb|AF203150.1| HIV-1 clone SP5-2-88 from USA nef... 90 3e-16 gi|6694499|gb|AF203145.1| HIV-1 clone SP5-1-84 from USA nef... 90 3e-16 gi|18201560|gb|AF219819.1|AF219819 HIV-1 isolate LTS 8a fro... 90 3e-16
>gi|555008|gb|K02083.1|HIVPV22 Human immunodeficiency virus type 1, isolate PV22, complete genome (H9/HTLV-III proviral DNA) Length = 9770 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9308 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9367
Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 190 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 249
>gi|1906382|gb|K03455.1|HIVHXB2CG Human immunodeficiency virus type 1 (HXB2), complete genome; HIV1/HTLV-III/LAV reference genome Length = 9719 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 240
Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 9268 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 9325
>gi|60192|emb|Z11530.1|HIVF12CG Human Immunodeficiency virus I (HIV-1) RNA Length = 9781 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9288 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9347
Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 178 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 237
>gi|632882|gb|S72421.1|S72421 {LTR, long terminal repeat} [human immunodeficiency virus type 1 HIV-1, 3B, Genomic RNA, 536 nt] Length = 536 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 240
>gi|61569|emb|X01762.1|REHTLV3 Human T-cell leukaemia type III (HTLV-III) proviral genome (AIDS virus for acquired immune deficiency syndrome) Length = 9748 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9295 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9354
Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 240
>gi|328381|gb|M74426.1|HIVNEF Human immunodeficiency virus type 1 nef gene sequence Length = 1050 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 585 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 644
>gi|61556|emb|X03188.1|REHIVXB3 Human T-lymphotropic virus type III (HTLV III) 3' ORF HXB3 RNA Length = 923 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 470 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 529
>gi|61552|emb|X03189.1|REHIVC15 Human T-lymphotropic virus type III (HTLV III) C15 RNA for 3'ORF Length = 769 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 398 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 457
>gi|665531|gb|U12055.1|HIV1U12055 Human immunodeficiency virus type 1 isolate LW12.3 from infected lab worker, complete genome Length = 9609 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9145 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9204
Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 199 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 258
>gi|1398964|dbj|D86069.1|HIV2132 Human immunodeficiency virus type 1 DNA for Gag, Pol, Vif, Vpr, Rev, Tat, Env, Vpu Length = 9754 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9301 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9360
>gi|474287|gb|L31963.1|HIVTH475A Human immunodeficiency virus type 1 (individual isolate: TH4-7-5) gene Length = 9795 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9303 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 9362
>gi|328453|gb|M11840.1|HIVPCV12 Human immunodeficiency virus type 1, vif, tat, rev and nef mRNA (clone 12 cDNA) Length = 2304 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1933 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 1992
>gi|329545|gb|M27499.1|HL2ORF Human T-cell lymphotropic virus type II DNA sequence, ORF Length = 768 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 398 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 457
>gi|326383|gb|M15654.1|HIVBH102 Human immunodeficiency virus type 1, isolate BH10, genome Length = 8932 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 8621 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 8680
>gi|326382|gb|M15653.1|HIVBH101 Human immunodeficiency virus type 1, isolate BH10, 5' LTR (partial) Length = 492 Score = 119 bits (60), Expect = 3e-25 Identities = 60/60 (100%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 240
>gi|4102257|gb|AF011470.1|AF011470 HIV-1 strain 8-it clone b from Italy, nef protein (nef) gene, complete cds Length = 627 Score = 115 bits (58), Expect = 5e-24 Identities = 58/58 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 478 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 535
>gi|2286133|gb|AF003888.1| HIV-1 chimeric molecular clone, complete sequence Length = 9718 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 162 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 217
Score = 65.9 bits (33), Expect = 4e-09 Identities = 51/57 (89%) Strand = Plus / Plus Query: 4 aaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||| | |||||||||||||||| |||||| |||||| ||||| ||||||| Sbjct: 9268 aaggagagaagaacagcttgttacaccctatgagccagcatgggatggaggacccgg 9324
>gi|2286124|gb|AF003887.1| HIV-1 chimeric molecular clone, complete sequence Length = 9739 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9288 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 9343
Score = 65.9 bits (33), Expect = 4e-09 Identities = 51/57 (89%) Strand = Plus / Plus Query: 4 aaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||| | |||||||||||||||| |||||| |||||| ||||| ||||||| Sbjct: 184 aaggagagaagaacagcttgttacaccctatgagccagcatgggatggaggacccgg 240
>gi|6694605|gb|AF203198.1| HIV-1 clone LTNP2-83 from USA nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|6694529|gb|AF203160.1| HIV-1 clone SP9-2-88 from USA nef protein (nef) gene, complete cds Length = 633 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 484 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 539
>gi|6694527|gb|AF203159.1| HIV-1 clone SP9-1-88 from USA nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|6694525|gb|AF203158.1| HIV-1 clone SP9-2-83 from USA nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|6694523|gb|AF203157.1| HIV-1 clone SP9-1-83 from USA truncated nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|3986717|gb|AF102209.1|AF102209 HIV-1 strain SE5658 from Sweden, 5' long terminal repeat, partial sequence Length = 496 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 112 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 167
>gi|12831134|gb|AF324493.1|AF324493 HIV-1 vector pNL4-3, complete sequence Length = 14824 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9258 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 9313
>gi|4730963|gb|AF063164.1|AF063164 HIV-1 isolate 9-it clone a from Italy, 3' LTR sequence Length = 520 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 238
>gi|4730962|gb|AF063163.1|AF063163 HIV-1 isolate 8-it clone b from Italy, 3' LTR sequence Length = 520 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 238
>gi|4730961|gb|AF063162.1|AF063162 HIV-1 isolate 7-it clone c from Italy, 3' LTR sequence Length = 521 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 238
>gi|4730960|gb|AF063161.1|AF063161 HIV-1 isolate 7-it clone b from Italy, 3' LTR sequence Length = 520 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 238
>gi|327466|gb|K02011.1|HIVH3BH8 HIV-1 isolate BH8 tat protein and rev protein genes, partial cds; vpu protein and envelope protein precursor, genes, complete cds; and long terminal repeat, partial sequence Length = 3563 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3254 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 3309
>gi|4105546|gb|AF047087.1|AF047087 HIV-1 isolate 21-sw clone a from Sweden, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|4102305|gb|AF011494.1|AF011494 HIV-1 strain 7-it clone b from Italy, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|4102277|gb|AF011480.1|AF011480 HIV-1 strain 12-it clone d from Italy, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcytgcatggaatggatgacccgg 529
>gi|4102263|gb|AF011473.1|AF011473 HIV-1 strain 9-it clone a from Italy, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|4102255|gb|AF011469.1|AF011469 HIV-1 strain 8-it clone a from Italy, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|3378121|gb|AF070521.1|AF070521 HIV-1 E9 from the USA, complete genome Length = 9699 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9248 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 9303
>gi|3169601|gb|AF063922.1|AF063922 HIV-1 patient 9 from Korea, nef protein (nef) gene, complete cds Length = 621 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 527
>gi|902798|gb|U26942.1|HIV1U26942 Human immunodeficiency virus clone pNL4-3, subclone 4.20 Length = 9000 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 8636 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 8691
>gi|326417|gb|K02013.1|HIVBRUCG Human immunodeficiency virus type 1, isolate BRU, complete genome (LAV-1) Length = 9229 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 8861 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 8916
>gi|415429|gb|S64870.1|S64870 {long terminal repeat, negative regulatory element NRE1} [human immunodeficiency virus type 1 HIV-1, Genomic, 761 nt] Length = 761 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 414 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 469
>gi|1398973|dbj|D86068.1|HIVMCK1 Human immunodeficiency virus type 1 DNA for Gag, Pol, Vif, Vpr, Tat, Rev, Env, Vpu Length = 9752 Score = 111 bits (56), Expect = 8e-23 Identities = 59/60 (98%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 9299 acaaaggagagaacaccagcttattacaccctgtgagcctgcatggaatggatgacccgg 9358
Score = 111 bits (56), Expect = 8e-23 Identities = 59/60 (98%) Strand = Plus / Plus Query: 1 acaaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 181 acaaaggagagaacaccagcttattacaccctgtgagcctgcatggaatggatgacccgg 240
>gi|328415|gb|M19921.1|HIVNL43 Human immunodeficiency virus type 1, NY5/BRU (LAV-1) recombinant clone pNL4-3 Length = 9709 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 9258 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 9313
>gi|291194|gb|M33914.1|HIV1U3RA Human immunodeficiency virus type 1 U3 region; R region Length = 550 Score = 111 bits (56), Expect = 8e-23 Identities = 56/56 (100%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 58 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgaccc 238
>gi|4558520|gb|AF033819.3| HIV-1, complete genome Length = 9181 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 8814 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 8871
>gi|4028599|gb|AF105229.1|AF105229 Cloning vector pHR'-CMVLacZ, complete sequence Length = 11686 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 6025 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 6082
Score = 97.6 bits (49), Expect = 1e-18 Identities = 55/57 (96%) Strand = Plus / Plus Query: 4 aaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| Sbjct: 186 aaggagagaacacccgcttgttacaccctgtgagcctgcatgggatggatgacccgg 242
>gi|61554|emb|X03187.1|REHIVXB2 Human T-lymphotropic virus type III (HTLV-III) 3'ORF HXB2 RNA Length = 923 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 472 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 529
>gi|829534|gb|U24480.1|HIV1U24480 Human immunodeficiency virus type 1 patient 3799(9-93), clone 9 LTR, (nef) gene, partial cds Length = 657 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 56 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 113
>gi|829533|gb|U24479.1|HIV1U24479 Human immunodeficiency virus type 1 patient 3799(9-93), clone 8 LTR, (nef) pseudogene, partial cds Length = 657 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 56 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 113
>gi|829531|gb|U24478.1|HIV1U24478 Human immunodeficiency virus type 1 patient 3799(9-93), clone 5 LTR, (nef) gene, partial cds Length = 657 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 56 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 113
>gi|829506|gb|U24474.1|HIV1U24474 Human immunodeficiency virus type 1 patient 3799(9-93), clone 4 LTR, (nef) gene, partial cds Length = 657 Score = 107 bits (54), Expect = 1e-21 Identities = 57/58 (98%) Strand = Plus / Plus Query: 3 aaaggagagaacaccagcttgttacaccctgtgagcctgcatggaatggatgacccgg 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 56 aaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccgg 113
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) Posted date: Oct 7, 2002 3:18 AM Number of letters in database: -8059 Number of sequences in database: 963,691 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 196,068 Number of Sequences: 1414977 Number of extensions: 196068 Number of successful extensions: 15020 Number of sequences better than 10.0: 3076 length of query: 60 length of database: 6,904,618,414 effective HSP length: 19 effective length of query: 41 effective length of database: 6,877,733,851 effective search space: 281987087891 effective search space used: 281987087891 T: 0 A: 30 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)
